 |
Information for unigene UN26167
| FASTA Sequence |
| Unigene ID: UN26167 | Length: 395 |
| SNP | GGGGTCCACCTTTGAGAAAAAATGGCAAGCAATATGGAAGTTTTCTGCGAGATCTTGATCGCAGTCCTTCTTCCTCCTCTTGGAGT
CTGCCTCAAGCGTGGCTGCTGCACTGTAGAGTTCTTGATATGCTTGGTGTTGACTATCTTAGGCTACATCCCAGGGATAATCTATG
CTATTTACGTGATCGTGTTTCAGAACCGTGAAGGGGAAACTCAGGACTACAGTGCTCCACTCAACTCAGCTTGAGACTATCTGCTG
GTCCATTCAATGTCTTTGAAACTGTTTTACTTATGTAATGTAACCATTAAATAAGTTGCTATGCAATCTCATCGGTTTCCTTATCA
TGTATATTCAGCTATTCAAGTCATGCCAATTTCATAGAATGACTTTTGACC
|
|
|
| GenBank top hits (Blast detail) | Score | e value |
|---|
| AAT11798 salt and low temperature response protein [Brassica rapa subsp. pekinensis] | 381 | 2e-035 |
| AAV35467 cold and salt response protein [Brassica napus] | 373 | 2e-034 |
| NP_194794 putative low temperature and salt responsive protein [Arabidopsis thaliana] | 339 | 2e-030 |
| XP_002869366 hypothetical protein ARALYDRAFT_913410 [Arabidopsis lyrata subsp. lyrata] | 326 | 6e-029 |
| XP_002869365 hypothetical protein ARALYDRAFT_913409 [Arabidopsis lyrata subsp. lyrata] | 307 | 9e-027 |
| Swiss-Prot top hits (Blast detail) | Score | e value |
|---|
| Q9M095 UPF0057 membrane protein At4g30650 | 339 | 6e-032 |
| Q9SUI0 UPF0057 membrane protein At4g30660 | 296 | 6e-027 |
| O82232 UPF0057 membrane protein At2g24040 | 253 | 6e-022 |
| Q9LRI7 Hydrophobic protein OSR8 | 204 | 3e-016 |
| Q9ZNQ7 Hydrophobic protein RCI2A | 177 | 4e-013 |
| TrEMBL top hits (Blast detail) | Score | e value |
|---|
| Q6GYJ6 Salt and low temperature response protein | 381 | 2e-035 |
| Q5URQ9 Cold and salt response protein | 373 | 1e-034 |
| C0SVK6 Putative uncharacterized protein At4g30650 (Fragment) | 339 | 1e-030 |
| B9DGR8 AT4G30660 protein | 291 | 4e-025 |
| B9STT9 Hydrophobic protein OSR8, putative | 268 | 2e-022 |
| Arabidopsis top hits (Blast detail) | Score | e value |
|---|
| AT4G30650.1 hydrophobic protein, putative / low temperature and salt responsive protein, putative | 343 | 3e-033 |
| AT4G30660.1 hydrophobic protein, putative / low temperature and salt responsive protein, putative | 297 | 7e-028 |
| AT4G30660.2 hydrophobic protein, putative / low temperature and salt responsive protein, putative | 297 | 7e-028 |
| AT4G28088.1 hydrophobic protein, putative / low temperature and salt responsive protein, putative | 257 | 3e-023 |
| AT2G24040.1 hydrophobic protein, putative / low temperature and salt responsive protein, putative | 253 | 9e-023 |
| EST library breakdown for ESTs in the assembly |
| Library |
ESTs | Percentage of ESTs in assembly |
|
|
|
|
